We offer a research-use-only, high-precision mtDNA Copy Number Quantification Test tailored for drug developers, CROs, and molecular biology labs. Our service delivers sensitive, reproducible quantification of mitochondrial copy number—critical for studies on mtDNA copy number variation, cancer, ageing, and metabolic disease. Benefit from rapid turnaround, custom sample compatibility, and N2 Jenomics Lab Pvt. Ltd. ' 10+ years of sequencing expertise.
Mitochondrial DNA copy number (mtDNA-CN) reflects the number of mitochondrial genomes per cell. This metric is a fundamental biomarker of mitochondrial activity and cellular bioenergetic health.
Mitochondria contain hundreds to thousands of mitochondrial genomes per cell, varying by tissue and physiology. Measuring mtDNA copy number per cell quantifies mitochondrial content and biogenesis.
Among assays, qPCR remains the gold standard, offering high sensitivity (>30 pg), quick turnaround, and high throughput. It supports one-tube quantification with dual-target detection (mtDNA vs nuclear DNA), yielding reliable results when using validated primers and TaqMan probes.
We offer a precision mtdna copy number qPCR service using a TaqMan probe-based assay that simultaneously measures mitochondrial and nuclear DNA in one reaction. This method ensures accurate quantification of mitochondrial DNA copy number with robust performance across diverse sample types.
Table: Primer Sequences Used in Our mtDNA Copy Number qPCR Assay
| Target Gene | Primer Name | Direction | Sequence (5′ → 3′) | Length (bp) |
|---|---|---|---|---|
| mt-ND1 | mt-ND1-F | Forward | TACGGGCTACTACAACCCTTC | 21 |
| mt-ND1 | mt-ND1-R | Reverse | ATGGTAGATGTGGCGGGTTT | 20 |
| mt-ND5 | mt-ND5-F | Forward | CATTACTAACAACATTTCCCCCGC | 24 |
| mt-ND5 | mt-ND5-R | Reverse | GGCTGTGAGTTTTAGGTAGAGGG | 23 |
| (Control) | SERPINA1-F | Forward | CAGTGAATAAATGAGGCGTACATCC | 25 |
| (Control) | SERPINA1-R | Reverse | GACTGTTTCTCATGCCTCTGGAAAG | 25 |
Note: For mtDNA copy number estimation, mt-ND1 is the primary target. SERPINA1 may serve as a nuclear reference gene (depending on context). No TaqMan probe sequences were listed; if probes are also available, I can include them.
Step 1: Sample Arrival & QC
Step 2: DNA Extraction (if needed)
Step 3: qPCR Setup & Run
Step 4: Data QC & Analysis
Step 5: Report Delivery


Cancer research
Detect mtDNA depletion or amplification in tumor vs. adjacent normal tissues.
Ageing and longevity studies
Monitor mitochondrial decline with age or after interventions (diet, drugs, exercise).
Metabolic and mitochondrial disorders
Identify alterations in mtDNA-CN linked to diabetes, obesity, or inherited mtDNA mutations.
Environmental and occupational exposure
Assess mitochondrial toxicity due to pollutants, radiation, or chemicals.
Pharmacology and toxicology
Evaluate drug-induced mitochondrial stress in preclinical safety studies.
Cell engineering & CRISPR screens
Confirm mitochondrial effects of gene edits or small-molecule treatments.
We use validated duplex qPCR assays with rigorous primer and probe design. Every result is backed by quality-controlled amplification curves, melt curve verification, and standard curve calibration.
From whole blood to saliva, tissues, and cultured cells, our platform accommodates a wide variety of input types—ensuring consistent mtDNA/nDNA ratio quantification across diverse research models.
Our deliverables include complete assay conditions, QC metrics, raw data files, and normalized copy number outputs—ready for downstream interpretation or regulatory documentation.
Our workflows meet research and preclinical standards. Whether you're conducting mechanistic studies, toxicity screens, or biomarker discovery, we help ensure data integrity at every step.
| Sample Type | Required Format & Amount | Recommended DNA Input |
|---|---|---|
| Whole blood | EDTA/heparin tubes, 1–5 mL | ≥ 5 ng per qPCR reaction |
| PBMCs | 1–5×10⁶ cells, fresh or frozen | ≥ 5 ng per reaction |
| Tissue (frozen/fresh) | ≥ 10 mg (snap-frozen/RNAlater) | ≥ 5 ng per reaction |
| Cultured cells | ≥ 1×10⁶ cells | ≥ 5 ng per reaction |
| Saliva / buccal swab | Collected in DNA-stabilizing buffer | ≥ 5 ng per reaction |
| Urine / CSF / lavage | 1–5 mL volume | Variable; aim ≥ 5 ng if possible |
| Purified gDNA | A260/280 ≈ 1.8–2.0; low fragmentation | ≥ 0.1 ng per reaction |


Mitochondrial DNA copy number (mtDNA-CN) refers to the average number of mitochondrial genome copies per cell. It's a key indicator of mitochondrial function, and deviations—either depletion or amplification—are linked to various conditions like cancer, ageing, and kidney disease.
Real-time qPCR is the gold standard for mtDNA copy number quantification due to its balance of sensitivity (down to ~30 pg DNA), efficiency, specificity, and throughput. It outperforms microarrays in cost and speed, making it ideal for CRO-driven workflows.
We accept EDTA blood, PBMCs, various tissue types, cultured cells, saliva, urine, CSF, and purified gDNA. We follow validated protocols tailored to sample type, ensuring consistent and reliable mtDNA copy number analysis.
Absolutely. Altered mtDNA-CN is well-documented across many cancer types including breast, kidney, and bladder cancers. Our mtdna copy number assay provides quantitative data to support cancer biomarker and mechanistic studies.
Our assay uses primers and probes targeting highly conserved regions of the mitochondrial genome (e.g., ND1, ND5) and includes a short nuclear gene reference. This design avoids NUMT co-amplification. Melt-curve and no-template controls further ensure specificity.
While qPCR performs best on intact DNA, our assays tolerate moderate fragmentation (<120 bp targets). Serial qPCR QC tests can also detect degraded DNA and exclude inaccurate samples.