Mitochondrial DNA Copy Number Quantification Test Home  > Mitochondrial DNA Copy Number Quantification Test
Mitochondrial DNA Copy Number qPCR Service

We offer a research-use-only, high-precision mtDNA Copy Number Quantification Test tailored for drug developers, CROs, and molecular biology labs. Our service delivers sensitive, reproducible quantification of mitochondrial copy number—critical for studies on mtDNA copy number variation, cancer, ageing, and metabolic disease. Benefit from rapid turnaround, custom sample compatibility, and N2 Jenomics Lab Pvt. Ltd. ' 10+ years of sequencing expertise.

 

Mitochondrial DNA Copy Number qPCR Service

Why Quantify Mitochondrial DNA Copy Number?

Mitochondrial DNA copy number (mtDNA-CN) reflects the number of mitochondrial genomes per cell. This metric is a fundamental biomarker of mitochondrial activity and cellular bioenergetic health.

Key Reasons Researchers Choose mtDNA-CN Quantification

  • Cancer biology & diagnostics
    mtDNA-CN is often altered across cancer types. In many tumors—especially bladder, breast, and kidney—it is lower compared with normal tissue. Quantifying this shift through an mtdna copy number assay supports biomarker discovery and therapeutic evaluation.
  • Age-related and metabolic diseases
    Low mtDNA-CN correlates with ageing, cardiovascular disease, chronic kidney dysfunction, and increased mortality. Accurate quantification of mitochondrial DNA copy number aids studies in metabolism, frailty, neurodegeneration, and ageing interventions.
  • Therapeutic development & toxicity testing
    Changes in mtDNA-CN can indicate mitochondrial dysfunction from drugs or environmental stress. Integrated into CRO pipelines, mtdna copy number qPCR helps flag mitochondrial toxicity and compare compound effects.
  • Methodological evaluation & standardisation
    Multiple platforms (qPCR, WGS, microarrays) can measure mtDNA-CN, but studies show qPCR remains cost-effective and rapid—provided DNA extraction and assay design are optimised .

What Is Mitochondrial DNA Copy Number?

Mitochondria contain hundreds to thousands of mitochondrial genomes per cell, varying by tissue and physiology. Measuring mtDNA copy number per cell quantifies mitochondrial content and biogenesis.

Evaluation of mtDNA Copy Number Estimation Techniques

Among assays, qPCR remains the gold standard, offering high sensitivity (>30 pg), quick turnaround, and high throughput. It supports one-tube quantification with dual-target detection (mtDNA vs nuclear DNA), yielding reliable results when using validated primers and TaqMan probes.

Our mtDNA Copy Number qPCR Assay 🧪

We offer a precision mtdna copy number qPCR service using a TaqMan probe-based assay that simultaneously measures mitochondrial and nuclear DNA in one reaction. This method ensures accurate quantification of mitochondrial DNA copy number with robust performance across diverse sample types.

Assay Overview & Technology

  • TaqMan hydrolysis probe chemistry boosts specificity: the 5′–3′ exonuclease cleaves the probe only when bound to the target—yielding fluorescence directly proportional to target DNA amount.
  • We target a conserved mtDNA region with custom-designed primers and probe to avoid amplification of nuclear mitochondrial pseudogenes (NUMTs).
  • A reference nuclear gene (e.g. IFNB1 or B2M) is amplified in parallel for normalization, enabling precise calculation of mtDNA-to-nDNA ratio per cell.

Performance Metrics

  • High sensitivity: reliably detects down to ~30 pg of input DNA.
  • Outstanding precision: coefficient of variation (CV) < 5% for Cq values; CV < 15% for calculated copies per cell.
  • Wide dynamic range: validated over serial dilutions, delivering linear standard curves (efficiency 90–110%).

Primer & Probe Design

  • mtDNA primers are mapped to the D-loop or ND1 region—chosen for high conservation and absence of NUMT homology.
  • Nuclear reference primer matches a single-copy gene (110 bp amplicon).
  • All designs are rigorously assessed for specificity with melt-curve, gel electrophoresis, and in-silico BLAST checks.

One-Step Copy Number Quantification

  • Dual-target amplification (mtDNA + nDNA) in one well.
  • Relative copy number: calculated via the ΔΔCq method.
  • Absolute copy number: by comparing to standard curves from reference DNA with known mtDNA-CN.

Off-Target Avoidance

  • Designed to exclude non-human and NUMT-derived amplicons—confirmed by high Cq values or no signal in negative/no-template controls.
  • Melt-curve analysis ensures single, specific amplification peak, avoiding primer-dimers or non-specific products.

Table: Primer Sequences Used in Our mtDNA Copy Number qPCR Assay

Target GenePrimer NameDirectionSequence (5′ → 3′)Length (bp)
mt-ND1mt-ND1-FForwardTACGGGCTACTACAACCCTTC21
mt-ND1mt-ND1-RReverseATGGTAGATGTGGCGGGTTT20
mt-ND5mt-ND5-FForwardCATTACTAACAACATTTCCCCCGC24
mt-ND5mt-ND5-RReverseGGCTGTGAGTTTTAGGTAGAGGG23
(Control)SERPINA1-FForwardCAGTGAATAAATGAGGCGTACATCC25
(Control)SERPINA1-RReverseGACTGTTTCTCATGCCTCTGGAAAG25

Note: For mtDNA copy number estimation, mt-ND1 is the primary target. SERPINA1 may serve as a nuclear reference gene (depending on context). No TaqMan probe sequences were listed; if probes are also available, I can include them.

Workflow Overview🔬

Step 1: Sample Arrival & QC

  • Receive blood, tissue, cells, or purified gDNA
  • Inspect labeling, tube integrity, and storage conditions
  • Perform DNA quantification (A260/280 ~1.8) and check input (≥ 5 ng)

Step 2: DNA Extraction (if needed)

  • Use organic solvent or commercial kit
  • Prefer organic methods to maintain consistent mtDNA/nDNA yield

Step 3: qPCR Setup & Run

  • Prepare duplex TaqMan assay (mtND1/ND5 + nuclear reference)
  • Run in triplicate with positive, no-template, and no-human controls

Step 4: Data QC & Analysis

  • Ensure triplicate Cq replicates have SD <0.5
  • Check amplification & melt curves for specificity
  • Calculate ΔCq and absolute mtDNA copy number vs standard curve

Step 5: Report Delivery

  • Provide detailed PDF report with data plots and QC metrics
  • Supply raw data files, analysis summary, and interpretation notes
  • Upload all deliverables to our secure online portal
Mitochondrial DNA Copy Number qPCR Workflow

Research Applications

Cancer research

Detect mtDNA depletion or amplification in tumor vs. adjacent normal tissues.

Ageing and longevity studies

Monitor mitochondrial decline with age or after interventions (diet, drugs, exercise).

Metabolic and mitochondrial disorders

Identify alterations in mtDNA-CN linked to diabetes, obesity, or inherited mtDNA mutations.

Environmental and occupational exposure

Assess mitochondrial toxicity due to pollutants, radiation, or chemicals.

Pharmacology and toxicology

Evaluate drug-induced mitochondrial stress in preclinical safety studies.

Cell engineering & CRISPR screens

Confirm mitochondrial effects of gene edits or small-molecule treatments.

Why Choose N2 Jenomics Lab Pvt. Ltd. ?

✅ Scientific Accuracy

We use validated duplex qPCR assays with rigorous primer and probe design. Every result is backed by quality-controlled amplification curves, melt curve verification, and standard curve calibration.

✅ Flexible Sample Compatibility

From whole blood to saliva, tissues, and cultured cells, our platform accommodates a wide variety of input types—ensuring consistent mtDNA/nDNA ratio quantification across diverse research models.

✅ End-to-End Data Transparency

Our deliverables include complete assay conditions, QC metrics, raw data files, and normalized copy number outputs—ready for downstream interpretation or regulatory documentation.

✅ CRO-Grade Reliability

Our workflows meet research and preclinical standards. Whether you're conducting mechanistic studies, toxicity screens, or biomarker discovery, we help ensure data integrity at every step.

Deliverables

  • Comprehensive PDF Report
    Includes methodology overview, primer/probe sequences, reaction conditions, amplification and melt curves, Cq values, standard curves, and normalized mtDNA/nDNA ratio, with quality flags for transparency.
  • Raw Data Export
    qPCR files (.csv, .xlsx) containing cycle thresholds and plate layout for integration with client data analysis pipelines.
  • Standard Curve Validation
    Demonstrated assay linearity (R² >0.99, efficiency 90–110%) and absolute copy number calibration.
  • Quality Assurance Metrics
    Coefficient of variation (CV) for Cq <5% and copy-per-cell estimates <15%, in line with RayBio kit performance.
  • Interpretation Summary
    Brief scientific context describing whether mtDNA-CN shows depletion or elevation relative to control thresholds.
  • Secure Data Portal Access
    PDF report and raw data accessible via CD Genomics' compliant online platform.

Sample Requirements

Sample TypeRequired Format & AmountRecommended DNA Input
Whole bloodEDTA/heparin tubes, 1–5 mL≥ 5 ng per qPCR reaction
PBMCs1–5×10⁶ cells, fresh or frozen≥ 5 ng per reaction
Tissue (frozen/fresh)≥ 10 mg (snap-frozen/RNAlater)≥ 5 ng per reaction
Cultured cells≥ 1×10⁶ cells≥ 5 ng per reaction
Saliva / buccal swabCollected in DNA-stabilizing buffer≥ 5 ng per reaction
Urine / CSF / lavage1–5 mL volumeVariable; aim ≥ 5 ng if possible
Purified gDNAA260/280 ≈ 1.8–2.0; low fragmentation≥ 0.1 ng per reaction

Demo Results

A demo bar chart showing relative mitochondrial DNA copy numbers across multiple samples
mtDNA copy number qPCR amplification and melting curve analysis

Mitochondrial DNA Copy Number Quantification Test FAQs

1. What is mitochondrial DNA copy number?

Mitochondrial DNA copy number (mtDNA-CN) refers to the average number of mitochondrial genome copies per cell. It's a key indicator of mitochondrial function, and deviations—either depletion or amplification—are linked to various conditions like cancer, ageing, and kidney disease.

2. Why use qPCR for mtDNA copy number quantification?

Real-time qPCR is the gold standard for mtDNA copy number quantification due to its balance of sensitivity (down to ~30 pg DNA), efficiency, specificity, and throughput. It outperforms microarrays in cost and speed, making it ideal for CRO-driven workflows.

3. How accurate is the qPCR approach?

  • Triplicate runs with SD < 0.5 ensure precision.
  • Assay sensitivity allows detection of subtle differences, though changes smaller than 2-fold may challenge accuracy.
  • Cross-validation studies, including PLOS COMPARISON of qPCR vs WGS/WES, confirm qPCR's reliability for mtDNA estimation .

4. What samples are compatible with your assay?

We accept EDTA blood, PBMCs, various tissue types, cultured cells, saliva, urine, CSF, and purified gDNA. We follow validated protocols tailored to sample type, ensuring consistent and reliable mtDNA copy number analysis.

5. Can this service detect mtDNA copy number variations in cancer studies?

Absolutely. Altered mtDNA-CN is well-documented across many cancer types including breast, kidney, and bladder cancers. Our mtdna copy number assay provides quantitative data to support cancer biomarker and mechanistic studies.

6. How do you handle nuclear mitochondrial sequences (NUMTs)?

Our assay uses primers and probes targeting highly conserved regions of the mitochondrial genome (e.g., ND1, ND5) and includes a short nuclear gene reference. This design avoids NUMT co-amplification. Melt-curve and no-template controls further ensure specificity.

7. Can low-quality or fragmented DNA be accurately quantified?

While qPCR performs best on intact DNA, our assays tolerate moderate fragmentation (<120 bp targets). Serial qPCR QC tests can also detect degraded DNA and exclude inaccurate samples.

Address: Registered Office: 150, Patparganj Industrial Area, New Delhi – 110092, India
Email: info@n2jenomicslab.com
Phone: +91-8287121443
Operational Address: National Institute of Plant Genome Research (BRIC - NGGF) Lab No. 206 and 207, Aruna Asaf Ali Marg, P.O. Box No. 10531, New Delhi – 110067, India
Follow Us:
1,856 Total Visitors
Copyright © 2026 | All rights reserved N2 Jenomics | Developed by Him Soft Solution